D by boiling in 10 mM citrate buffer, pH 6.0. Slides were blocked
D by boiling in 10 mM citrate buffer, pH 6.0. Slides were blocked in...
Easured using realtime PCR. B. Electron transport system abnormalities are more
Easured using realtime PCR. B. Electron transport system abnormalities are more abundant in rats...
Er 40X and 60X magnification. Statistical Analysis. Significance was determined at
Er 40X and 60X magnification. Statistical Analysis. Significance was determined at a P-value 0.05....
Solution against 70 mL of the same reservoir solution. Crystals appeared within
Solution against 70 mL of the same reservoir solution. Crystals appeared within a day...
Tion; our goal was to have a large enough cohort for
Tion; our goal was to have a large enough cohort for behavioral and tissue...
Ften interlinked by ultra-fine DNA bridge (UFB) which may facilitate efficient
Ften interlinked by ultra-fine DNA bridge (UFB) which may facilitate efficient end-joining of the...
Erformed with Microsoft Excel 2010 and R version 2.11.1.hTAAR9_fwd2: GCATATGAATTCATGGTGAACAATTTCTCCCAAG hTAAR
Erformed with Microsoft Excel 2010 and R version 2.11.1.hTAAR9_fwd2: GCATATGAATTCATGGTGAACAATTTCTCCCAAG hTAAR9_rv2: GCTATCAGTAATGTTTTTAATCTGTCTCTACTTCTTCStatisticsFor electrophysiological measurements...
By CDA-2, based on the inhibition of NF-kB in myeloid cells
By CDA-2, based on the inhibition of NF-kB in myeloid cells of tumor microenvironments.Materials...
Ice received 3 series of images, including CT, PET, and a merge
Ice received 3 series of images, including CT, PET, and a merge of CT...
H additive model [OR = 1.896, 95 CI(1.172, 3.067), p = 0.009] and dominant model [OR = 1.329, 95 CI
H additive model and dominant...