M a proximate mechanistic point of view, the ability to access the representational
M a proximate mechanistic viewpoint, the ability to access the representational content of one’s...
Y lower in common marmosets than in humans while those of
Y lower in common marmosets than in humans while those of IL-10, IL-12b and...
Act scale of dataset (1.2 Gb), may demonstrate an applicable practice of
Act scale of dataset (1.2 Gb), may demonstrate an applicable practice of metagenomic technology...
Rboxytetramethylrhodamine; MGBNFQ, minor groove binding nonfluorescent quencher. doi:10.1371/journal.pone.0052719.ta
Rboxytetramethylrhodamine; MGBNFQ, minor groove binding nonfluorescent quencher. doi:10.1371/journal.pone.0052719.ta bReal-Time PCR Detection of Plasmodium in...
Resources, and thus is crucial for wide application of metagenomic techniques.
Resources, and thus is crucial for wide application of metagenomic techniques. Unfortunately although TA02...
Rimer CCACCGACTCGTACAAGGTT and reverse primer ACTTCTTTGGCCTCCTGGAT were used. (B) Nampt protein
Rimer CCACCGACTCGTACAAGGTT and reverse primer ACTTCTTTGGCCTCCTGGAT were used. (B) Nampt protein was detected in...
E disease condition [27,31?3]. Furthermore, in neuroendocrine or small cell prostate cancer
E disease condition . Furthermore, in neuroendocrine or small cell prostate cancer, very little...
Roduce such features in extremely large systems as proteins, including huge
Roduce such features in extremely large systems as proteins, including huge number of chromophores....
S transformed into BL21(DE3) cells and expressed alone. Protein expression
S transformed into BL21(DE3) cells and expressed alone. Protein expression was induced at culture...
Acterial strains at 100 CM THP1IL4I1; **p,0.01 for E. coli
Acterial strains at 100 CM THP1IL4I1; **p,0.01 for E. coli, B2599 and MSSA and...