Ften interlinked by ultra-fine DNA bridge (UFB) which may facilitate efficient
Ften interlinked by ultra-fine DNA bridge (UFB) which may facilitate efficient end-joining of the...
Erformed with Microsoft Excel 2010 and R version 2.11.1.hTAAR9_fwd2: GCATATGAATTCATGGTGAACAATTTCTCCCAAG hTAAR
Erformed with Microsoft Excel 2010 and R version 2.11.1.hTAAR9_fwd2: GCATATGAATTCATGGTGAACAATTTCTCCCAAG hTAAR9_rv2: GCTATCAGTAATGTTTTTAATCTGTCTCTACTTCTTCStatisticsFor electrophysiological measurements...
By CDA-2, based on the inhibition of NF-kB in myeloid cells
By CDA-2, based on the inhibition of NF-kB in myeloid cells of tumor microenvironments.Materials...
Ice received 3 series of images, including CT, PET, and a merge
Ice received 3 series of images, including CT, PET, and a merge of CT...
H additive model [OR = 1.896, 95 CI(1.172, 3.067), p = 0.009] and dominant model [OR = 1.329, 95 CI
H additive model and dominant...
Ies among healthy subjects with low and high (L/H) LDAEP
Ies among healthy subjects with low and high (L/H) LDAEP of five 1379592 electrodes.BDNF...
The effects of blebbistatin, an NMMII inhibitor, were compared with the effects of reversine
extracts was sufficient to complement splicing of the Ftz reporter pre-mRNA similar to the...
Nal.pone.0052096.gInfusion Tol-DC Prolongs Islet Allograft SurvivalFigure 3. Effects of allopeptide-pulsed
Nal.pone.0052096.gInfusion Tol-DC Prolongs Islet Allograft SurvivalFigure 3. Effects of allopeptide-pulsed host Epigenetic Reader Domain...
The periplasmic domain contains chemoreceptor sites that monitor serine concentrations in the environment
d apoptosis and hypertrophy. The effects were mediated by the upregulation of an autophagy...
By PEITCFigure 2. Growth suppression of tumor cells in brain. (A) The
By PEITCFigure 2. Growth suppression of tumor cells in brain. (A) The MDA-MB-231 (BR)...